|
|
| GeneID |
165055
|
| Symbol |
CCDC138
|
| Synonyms |
FLJ32745
|
| Description |
coiled-coil domain containing 138 |
| See related |
HGNC:26531|Ensembl:ENSG00000163006|HPRD:08136| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
2q13 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_I | genome scan meta-analysis | Psr: 0.0004 | | | GSMA_IIA | genome scan meta-analysis (All samples) | Psr: 0.00755 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| miR-433-3p | 107 | 114 | 1A,m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
