Gene Page: LCA5

Summary
GeneID  167691
Symbol  LCA5
Synonyms  C6orf152
Description  Leber congenital amaurosis 5
See related  HGNC:31923|MIM:611408|Ensembl:ENSG00000135338|HPRD:10791|
Locus tag  -
Gene type  protein-coding
Map location  6q14.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0015031protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonIEA-
GO:0005737cytoplasmIEA-
GO:0005929ciliumIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-369-3p59651Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-37459661A,m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-493-5p189719041A,m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-543164816541Ahsa-miR-543AAACAUUCGCGGUGCACUUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.