|
|
| GeneID |
186
|
| Symbol |
AGTR2
|
| Synonyms |
AT2|ATGR2|MRX88
|
| Description |
angiotensin II receptor, type 2 |
| See related |
HGNC:338|MIM:300034|Ensembl:ENSG00000180772|HPRD:02071| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
Xq22-q23 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 | | | Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0576 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0004872 | receptor activity | IEA | | - |
| GO:0004947 | bradykinin receptor activity | IEA | | - |
| GO:0005515 | protein binding | IPI | | 18344519 |
| GO:0004945 | angiotensin type II receptor activity | TAS | | 8502225 |
| GO:0048019 | receptor antagonist activity | TAS | | 17159079 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0007420 | brain development | NAS | Brain (GO term level: 7) | 12089445 |
| GO:0002035 | brain renin-angiotensin system | IEA | Brain (GO term level: 12) | - |
| GO:0001991 | regulation of systemic arterial blood pressure by circulatory renin-angiotensin | ISS | | - |
| GO:0002033 | vasodilation by angiotensin involved in regulation of systemic arterial blood pressure | IEA | | - |
| GO:0001974 | blood vessel remodeling | TAS | | 17159080 |
| GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | | - |
| GO:0007199 | G-protein signaling, coupled to cGMP nucleotide second messenger | ISS | | 17000928 |
| GO:0008217 | regulation of blood pressure | TAS | | 7477266 |
| GO:0007263 | nitric oxide mediated signal transduction | IC | | 17000928 |
| GO:0007263 | nitric oxide mediated signal transduction | TAS | | 17159080 |
| GO:0007243 | protein kinase cascade | ISS | | 17000928 |
| GO:0010459 | negative regulation of heart rate | ISS | | - |
| GO:0007610 | behavior | IMP | | 12089445 |
| GO:0007610 | behavior | ISS | | - |
| GO:0043065 | positive regulation of apoptosis | IMP | | 10406457 |
| GO:0051000 | positive regulation of nitric-oxide synthase activity | ISS | | 17000928 |
| GO:0030308 | negative regulation of cell growth | TAS | | 17159080 |
| GO:0032516 | positive regulation of phosphoprotein phosphatase activity | IDA | | 10406457 |
| GO:0045909 | positive regulation of vasodilation | IDA | | 15117835 |17159079 |
| GO:0043537 | negative regulation of blood vessel endothelial cell migration | NAS | | 15710780 |
| GO:0045429 | positive regulation of nitric oxide biosynthetic process | IC | | 17000928 |
| GO:0051387 | negative regulation of nerve growth factor receptor signaling pathway | IMP | | 10406457 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005886 | plasma membrane | IEA | | - |
| GO:0005887 | integral to plasma membrane | TAS | | 7945336 |
| |
|
|
| |
|
| miR-330 | 846 | 853 | 1A,m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|