Gene Page: S1PR3

Summary
GeneID  1903
Symbol  S1PR3
Synonyms  EDG-3|EDG3|FLJ37523|FLJ93220|LPB3|MGC71696|S1P3
Description  sphingosine-1-phosphate receptor 3
See related  HGNC:3167|MIM:601965|Ensembl:ENSG00000213694|HPRD:03572|
Locus tag  -
Gene type  protein-coding
Map location  9q22.1-q22.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0445 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0001619lysosphingolipid and lysophosphatidic acid receptor activityIEA-
GO:0004872receptor activityIEA-
GO:0008289lipid bindingTAS9409733 
GO:0015078hydrogen ion transmembrane transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007204elevation of cytosolic calcium ion concentrationTAS9409733 
GO:0007186G-protein coupled receptor protein signaling pathwayTAS10617617 
GO:0007193G-protein signaling, adenylate cyclase inhibiting pathwayIEA-
GO:0007165signal transductionIEA-
GO:0008284positive regulation of cell proliferationTAS10617617 
GO:0009653anatomical structure morphogenesisTAS10555146 
GO:0006954inflammatory responseTAS8649355 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005886plasma membraneTAS9409733 
GO:0005887integral to plasma membraneTAS9409733 
GO:0016469proton-transporting two-sector ATPase complexIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
GNA13G13 | MGC46138guanine nucleotide binding protein (G protein), alpha 13-HPRD10488065 
GNAI1Giguanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1-HPRD10488065 
GNAQG-ALPHA-q | GAQguanine nucleotide binding protein (G protein), q polypeptide-HPRD10488065 
HTR1A5-HT1A | 5HT1a | ADRB2RL1 | ADRBRL15-hydroxytryptamine (serotonin) receptor 1A5-HT1A interacts with EDG3. This interaction was modeled on a demonstrated interaction between 5-HT1A and EDG3 from an unspecified species.BIND11854302 
-HPRD,BioGRID11854302 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-3p3613681A,m8hsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
miR-495262526321A,m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.