Gene Page: ETV4

Summary
GeneID  2118
Symbol  ETV4
Synonyms  E1A-F|E1AF|PEA3|PEAS3
Description  ets variant 4
See related  HGNC:3493|MIM:600711|Ensembl:ENSG00000175832|HPRD:02833|
Locus tag  -
Gene type  protein-coding
Map location  17q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
GO:0016563transcription activator activityNAS-
GO:0043565sequence-specific DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008045motor axon guidanceIEAneuron, axon (GO term level: 14)-
GO:0006355regulation of transcription, DNA-dependentNAS-
GO:0009887organ morphogenesisIEA-
GO:0045941positive regulation of transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusNAS-
GO:0005730nucleolusIDA18029348 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-29471477m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.