Gene Page: KDM1B
Summary ?
| GeneID | 221656 |
| Symbol | KDM1B |
| Synonyms | AOF1|C6orf193|LSD2|bA204B7.3|dJ298J15.2 |
| Description | lysine demethylase 1B |
| Reference | MIM:613081|HGNC:HGNC:21577|Ensembl:ENSG00000165097|HPRD:18524|Vega:OTTHUMG00000014316 |
| Gene type | protein-coding |
| Map location | 6p22.3 |
| Pascal p-value | 0.173 |
| Fetal beta | 0.223 |
| eGene | Cerebellum Myers' cis & trans Meta |
| Support | Chromatin Remodeling Genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs621071 | chr1 | 182682810 | KDM1B | 221656 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0009055 | electron carrier activity | IEA | - | |
| GO:0016491 | oxidoreductase activity | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0055114 | oxidation reduction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 6P24 P22 AMPLICON | 21 | 17 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
| FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 448 | 454 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-129-5p | 810 | 817 | 1A,m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-145 | 933 | 939 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
| miR-199 | 932 | 938 | 1A | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
| miR-450 | 810 | 816 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
| miR-504 | 1104 | 1110 | m8 | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
| miR-93.hd/291-3p/294/295/302/372/373/520 | 187 | 194 | 1A,m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
| hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
| hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
| hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
| hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
| hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
| hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
| hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
| hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
| hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
| hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
| hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.