Gene Page: PXDC1
Summary ?
| GeneID | 221749 |
| Symbol | PXDC1 |
| Synonyms | C6orf145 |
| Description | PX domain containing 1 |
| Reference | HGNC:HGNC:21361|Ensembl:ENSG00000168994|HPRD:12854|Vega:OTTHUMG00000014146 |
| Gene type | protein-coding |
| Map location | 6p25.2 |
| Pascal p-value | 0.006 |
| Sherlock p-value | 0.647 |
| Fetal beta | -0.087 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Montano_2016 | Genome-wide DNA methylation analysis | This dataset includes 172 replicated associations between CpGs with schizophrenia. | 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg05919456 | 6 | 3722818 | PXDC1 | 8.02E-5 | -0.009 | 0.113 | DMG:Montano_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2296890 | chr13 | 113087038 | C6orf145 | 221749 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| GO:0035091 | phosphoinositide binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007154 | cell communication | IEA | - |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-186 | 944 | 950 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-496 | 912 | 918 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.