|
|
| GeneID |
2218
|
| Symbol |
FKTN
|
| Synonyms |
CMD1X|FCMD|LGMD2M|MGC126857|MGC134944|MGC134945|MGC138243
|
| Description |
fukutin |
| See related |
HGNC:3622|MIM:607440|Ensembl:ENSG00000106692|HPRD:06308| |
| Locus tag |
RP11-235C23.1 |
| Gene type |
protein-coding |
| Map location |
9q31-q33 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0016740 | transferase activity | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9690476 |
| GO:0007517 | muscle development | TAS | | 9690476 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0000139 | Golgi membrane | IEA | | - |
| GO:0005794 | Golgi apparatus | IEA | | - |
| GO:0005615 | extracellular space | TAS | | 9690476 |
| GO:0016020 | membrane | IEA | | - |
| GO:0016021 | integral to membrane | IEA | | - |
| |
|
| miR-9 | 94 | 101 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
