Gene Page: FOXK1
Summary ?
GeneID | 221937 |
Symbol | FOXK1 |
Synonyms | FOXK1L |
Description | forkhead box K1 |
Reference | MIM:616302|HGNC:HGNC:23480|Ensembl:ENSG00000164916|HPRD:18750|Vega:OTTHUMG00000151739 |
Gene type | protein-coding |
Map location | 7p22.1 |
Pascal p-value | 0.047 |
Fetal beta | -0.402 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg07642754 | 7 | 4763655 | FOXK1 | 3.1E-5 | 0.609 | 0.019 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0016564 | transcription repressor activity | IEA | - | |
GO:0016563 | transcription activator activity | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007519 | skeletal muscle development | IEA | neuron (GO term level: 8) | - |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
GO:0045892 | negative regulation of transcription, DNA-dependent | IEA | - | |
GO:0045893 | positive regulation of transcription, DNA-dependent | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
WANG CLIM2 TARGETS DN | 186 | 114 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 7P22 AMPLICON | 38 | 27 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
LINSLEY MIR16 TARGETS | 206 | 127 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-155 | 529 | 535 | 1A | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
miR-181 | 8477 | 8483 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-200bc/429 | 8428 | 8434 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-203.1 | 8412 | 8418 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-23 | 8479 | 8485 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 8479 | 8485 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-365 | 528 | 534 | 1A | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
miR-485-3p | 214 | 220 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.