Gene Page: GPRC6A
Summary ?
GeneID | 222545 |
Symbol | GPRC6A |
Synonyms | GPCR|bA86F4.3 |
Description | G protein-coupled receptor class C group 6 member A |
Reference | MIM:613572|HGNC:HGNC:18510|Ensembl:ENSG00000173612|HPRD:17074|Vega:OTTHUMG00000015447 |
Gene type | protein-coding |
Map location | 6q22.1 |
Pascal p-value | 0.023 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004872 | receptor activity | IEA | - | |
GO:0004930 | G-protein coupled receptor activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
GO:0007165 | signal transduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK | 205 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA Q SIGNALLING EVENTS | 184 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS C 3 METABOTROPIC GLUTAMATE PHEROMONE RECEPTORS | 15 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-494 | 35 | 41 | m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.