Gene Page: FHL2

Summary
GeneID  2274
Symbol  FHL2
Synonyms  AAG11|DRAL|SLIM3
Description  four and a half LIM domains 2
See related  HGNC:3703|MIM:602633|Ensembl:ENSG00000115641|HPRD:04026|
Locus tag  -
Gene type  protein-coding
Map location  2q12-q14
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0004 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00755 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.1673 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
ZNF2500.930.87
VANGL20.930.83
NCK20.930.89
BRD10.930.89
SEZ60.930.91
SMARCA40.930.88
MIDN0.930.87
CSNK1E0.930.90
PHF20.930.88
MED120.930.85
Top 10 negatively co-expressed genes
C5orf53-0.66-0.76
AIFM3-0.66-0.78
SERPINB6-0.65-0.73
HLA-F-0.65-0.72
ALDOC-0.64-0.69
FBXO2-0.64-0.61
LDHD-0.64-0.66
S100B-0.64-0.84
HEPN1-0.63-0.71
CLU-0.63-0.68
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003713transcription coactivator activityNAS15572661 
GO:0005515protein bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0042802identical protein bindingIPI18255255 
GO:0046872metal ion bindingIEA-
GO:0050681androgen receptor bindingNAS15572661 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006357regulation of transcription from RNA polymerase II promoterIEA-
GO:0006350transcriptionIEA-
GO:0030521androgen receptor signaling pathwayNAS15572661 
GO:0045893positive regulation of transcription, DNA-dependentNAS15572661 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonIDA18029348 
GO:0005634nucleusIEA-
GO:0005634nucleusTAS9150430 
GO:0005737cytoplasmIEA-
GO:0005925focal adhesionIDA18029348 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AK1-adenylate kinase 1An unspecified isoform of FHL2 (DRAL/FHL-2) interacts with AK1. This interaction was modelled on a demonstrated interaction between an unspecified isoform of human FHL2 and AK1 from an unspecified species.BIND12432079 
-HPRD,BioGRID12432079 
ARAIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFMandrogen receptor-HPRD,BioGRID10654935 
BRCA1BRCAI | BRCC1 | IRIS | PSCP | RNF53breast cancer 1, early onsetAffinity Capture-Western
Reconstituted Complex
Two-hybrid		BioGRID14550570 |14986435 
CAPN1CANP | CANP1 | CANPL1 | muCANP | muCLcalpain 1, (mu/I) large subunitCAPN1 interacts with FHL2.BIND12358155 
CARD8CARDINAL | DACAR | DKFZp779L0366 | Dakar | FLJ18119 | FLJ18121 | KIAA0955 | MGC57162 | NDPP | NDPP1 | TUCANcaspase recruitment domain family, member 8-HPRD12067710 
CKMCKMM | M-CKcreatine kinase, muscleReconstituted ComplexBioGRID12432079 
An unspecified isoform of FHL2 (DRAL/FHL-2) interacts with CKM (MM-CK).BIND12432079 
CREB1CREB | MGC9284cAMP responsive element binding protein 1Affinity Capture-Western
Two-hybrid		BioGRID11046156 
CTNNB1CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923catenin (cadherin-associated protein), beta 1, 88kDa-HPRD,BioGRID12466281 
E2F1E2F-1 | RBAP1 | RBBP3 | RBP3E2F transcription factor 1Two-hybridBioGRID12411495 
E2F1 interacts with a molecule expressed by Gene FHL2. The precise molecular variant of FHL2 involved in this interaction is not specified.BIND12411495 
E2F2E2F-2E2F transcription factor 2Two-hybridBioGRID12411495 
E2F2 interacts with a molecule expressed by Gene FHL2. The precise molecular variant of FHL2 involved in this interaction is not specified.BIND12411495 
E2F3DKFZp686C18211 | E2F-3 | KIAA0075 | MGC104598E2F transcription factor 3Two-hybridBioGRID12411495 
E2F3 interacts with a molecule expressed by Gene FHL2. The precise molecular variant of FHL2 involved in this interaction is not specified.BIND12411495 
E2F4E2F-4E2F transcription factor 4, p107/p130-bindingTwo-hybridBioGRID12411495 
E2F4 interacts with a molecule expressed by Gene FHL2. The precise molecular variant of FHL2 involved in this interaction is not specified.BIND12411495 
EIF62 | CAB | EIF3A | ITGB4BP | b | b(2)gcn | gcn | p27BBPeukaryotic translation initiation factor 6Affinity Capture-Western
Two-hybrid		BioGRID10906324 
ESR1DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1estrogen receptor 1ER-alpha interacts with FHL2.BIND15666801 
FHL1FHL1B | FLH1A | KYO-T | MGC111107 | SLIM1 | XMPMA | bA535K18.1four and a half LIM domains 1-HPRD,BioGRID12432079 
FHL2AAG11 | DRAL | SLIM3four and a half LIM domains 2Two-hybridBioGRID11046156 
-HPRD10906324 
FHL3MGC19547 | MGC23614 | MGC8696 | SLIM2four and a half LIM domains 3-HPRD,BioGRID11135358 
FHL5ACT | FLJ33049 | KIAA0776 | RP3-393D12.2 | dJ393D12.2four and a half LIM domains 5-HPRD11046156 
FOXO1FKH1 | FKHR | FOXO1Aforkhead box O1FOXO1A interacts with FHL2.BIND15692560 
IGFBP5IBP5insulin-like growth factor binding protein 5-HPRD,BioGRID11821401 
ITGA3CD49C | FLJ34631 | FLJ34704 | GAP-B3 | GAPB3 | MSK18 | VCA-2 | VL3A | VLA3aintegrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)-HPRD,BioGRID10906324 
ITGA7FLJ25220integrin, alpha 7Affinity Capture-Western
Co-localization
Two-hybrid		BioGRID15117962 
ITGB1CD29 | FNRB | GPIIA | MDF2 | MSK12 | VLA-BETA | VLABintegrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)Affinity Capture-Western
Two-hybrid		BioGRID10906324 
ITGB2CD18 | LAD | LCAMB | LFA-1 | MAC-1 | MF17 | MFI7integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)-HPRD,BioGRID10906324 
ITGB6-integrin, beta 6-HPRD,BioGRID10906324 
MAPK1ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapkmitogen-activated protein kinase 1Affinity Capture-Western
Reconstituted Complex
Two-hybrid		BioGRID14729955 
MCM7CDABP0042 | CDC47 | MCM2 | P1.1-MCM3 | P1CDC47 | P85MCM | PNAS-146minichromosome maintenance complex component 7-HPRD,BioGRID10649446 
PFKMGSD7 | MGC8699 | PFK-1 | PFK-M | PFKXphosphofructokinase, muscleReconstituted ComplexBioGRID12432079 
PSEN2AD3L | AD4 | PS2 | STM2presenilin 2 (Alzheimer disease 4)-HPRD,BioGRID11001931 
REV1FLJ21523 | MGC163283 | MGC26225 | REV1LREV1 homolog (S. cerevisiae)-HPRD10906324 
SFPQPOMP100 | PSFsplicing factor proline/glutamine-rich (polypyrimidine tract binding protein associated)-HPRD,BioGRID11161712 
SIRT1SIR2L1sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)FHL2 interacts with SIRT1.BIND15692560 
SRFMCM1serum response factor (c-fos serum response element-binding transcription factor)SRF interacts with FHL2.BIND15610731 
TTNCMD1G | CMH9 | CMPD4 | CONNECTIN | DKFZp451N061 | EOMFC | FLJ26020 | FLJ26409 | FLJ32040 | FLJ34413 | FLJ39564 | FLJ43066 | HMERF | LGMD2J | TMDtitinAn unspecified isoform of FHL2 (DRAL) interacts with TTN (titin).BIND12432079 
-HPRD,BioGRID12432079 
ZBTB16PLZF | ZNF145zinc finger and BTB domain containing 16-HPRD,BioGRID12145280 
ZNF638DKFZp686P1231 | MGC26130 | MGC90196 | NP220 | ZFML | Zfp638zinc finger protein 638-HPRD,BioGRID11813260 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-5p2812871Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-25/32/92/363/367313319m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.