Gene Page: MORC2
Summary ?
| GeneID | 22880 |
| Symbol | MORC2 |
| Synonyms | CMT2Z|ZCW3|ZCWCC1 |
| Description | MORC family CW-type zinc finger 2 |
| Reference | MIM:616661|HGNC:HGNC:23573|Ensembl:ENSG00000133422|HPRD:11699|Vega:OTTHUMG00000151193 |
| Gene type | protein-coding |
| Map location | 22q12.2 |
| Pascal p-value | 0.006 |
| Sherlock p-value | 0.643 |
| eGene | Meta |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CAMK2A | 0.95 | 0.87 |
| SYNPO | 0.95 | 0.89 |
| PACSIN1 | 0.94 | 0.86 |
| DGKZ | 0.93 | 0.88 |
| SNPH | 0.93 | 0.93 |
| EXTL1 | 0.93 | 0.88 |
| AC105206.1 | 0.93 | 0.92 |
| MICAL2 | 0.93 | 0.90 |
| IQSEC3 | 0.92 | 0.94 |
| CNTNAP1 | 0.92 | 0.90 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| BCL7C | -0.56 | -0.60 |
| C9orf46 | -0.54 | -0.54 |
| RBMX2 | -0.52 | -0.54 |
| DYNLT1 | -0.52 | -0.57 |
| GTF3C6 | -0.52 | -0.50 |
| RPL23A | -0.51 | -0.54 |
| RPS8 | -0.50 | -0.50 |
| TUBB2B | -0.50 | -0.45 |
| EXOSC8 | -0.50 | -0.44 |
| RPL27A | -0.50 | -0.58 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005524 | ATP binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
| WANG HCP PROSTATE CANCER | 111 | 69 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS DN | 105 | 63 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 1HR DN | 222 | 147 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
| SMIRNOV RESPONSE TO IR 2HR DN | 55 | 35 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-186 | 145 | 151 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.