Gene Page: PAXIP1
Summary ?
| GeneID | 22976 |
| Symbol | PAXIP1 |
| Synonyms | CAGF28|CAGF29|PACIP1|PAXIP1L|PTIP|TNRC2 |
| Description | PAX interacting protein 1 |
| Reference | MIM:608254|HGNC:HGNC:8624|Ensembl:ENSG00000157212|HPRD:08491|Vega:OTTHUMG00000151322 |
| Gene type | protein-coding |
| Map location | 7q36 |
| Pascal p-value | 0.001 |
| eGene | Myers' cis & trans |
| Support | Chromatin Remodeling Genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg22583711 | 7 | 154795321 | PAXIP1;LOC202781 | 3.756E-4 | -0.22 | 0.043 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs16829545 | chr2 | 151977407 | PAXIP1 | 22976 | 0.03 | trans | ||
| rs6741060 | chr2 | 217169088 | PAXIP1 | 22976 | 0.17 | trans | ||
| rs16955618 | chr15 | 29937543 | PAXIP1 | 22976 | 0.03 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ABR | 0.93 | 0.92 |
| PIP5K1C | 0.91 | 0.90 |
| PITPNM2 | 0.90 | 0.90 |
| SCAMP5 | 0.89 | 0.87 |
| OSBP2 | 0.89 | 0.89 |
| PVRL1 | 0.89 | 0.89 |
| PCNXL2 | 0.88 | 0.86 |
| CLSTN1 | 0.87 | 0.85 |
| FBXO10 | 0.87 | 0.86 |
| CACNB1 | 0.87 | 0.87 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| GNG11 | -0.54 | -0.57 |
| AL139819.3 | -0.53 | -0.53 |
| AF347015.21 | -0.53 | -0.48 |
| C1orf54 | -0.52 | -0.55 |
| AP002478.3 | -0.51 | -0.52 |
| DBI | -0.50 | -0.55 |
| AF347015.31 | -0.48 | -0.45 |
| AL138743.2 | -0.48 | -0.50 |
| C1orf61 | -0.48 | -0.53 |
| HIGD1B | -0.47 | -0.44 |
Section III. Gene Ontology annotation
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0031965 | nuclear membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN | 234 | 147 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION DN | 84 | 54 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| AMUNDSON RESPONSE TO ARSENITE | 217 | 143 | All SZGR 2.0 genes in this pathway |
| KIM MYC AMPLIFICATION TARGETS DN | 97 | 51 | All SZGR 2.0 genes in this pathway |
| PUJANA XPRSS INT NETWORK | 168 | 103 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB MORPHOLINO DN | 200 | 112 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR DN | 25 | 15 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
| PUJANA BREAST CANCER WITH BRCA1 MUTATED DN | 9 | 5 | All SZGR 2.0 genes in this pathway |
| CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-299-3p | 230 | 236 | m8 | hsa-miR-299-3p | UAUGUGGGAUGGUAAACCGCUU |
| miR-369-3p | 210 | 217 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-374 | 211 | 217 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| miR-490 | 257 | 263 | m8 | hsa-miR-490 | CAACCUGGAGGACUCCAUGCUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.