Gene Page: UNC13A
Summary ?
| GeneID | 23025 |
| Symbol | UNC13A |
| Synonyms | Munc13-1 |
| Description | unc-13 homolog A (C. elegans) |
| Reference | MIM:609894|HGNC:HGNC:23150|Ensembl:ENSG00000130477|Vega:OTTHUMG00000163877 |
| Gene type | protein-coding |
| Map location | 19p13.11 |
| Pascal p-value | 0.016 |
| Fetal beta | -1.842 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
| Support | CANABINOID EXOCYTOSIS METABOTROPIC GLUTAMATE RECEPTOR SEROTONIN G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| UNC13A | chr19 | 17738735 | C | T | NM_001080421 | p.1256M>I | missense | Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg10490206 | 19 | 17798846 | UNC13A | 1.05E-7 | -0.012 | 2.3E-5 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7094698 | chr10 | 3183746 | UNC13A | 23025 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| YWHAG | 0.93 | 0.93 |
| WDR37 | 0.92 | 0.93 |
| GABRB3 | 0.92 | 0.94 |
| UBQLN1 | 0.92 | 0.93 |
| EAF1 | 0.91 | 0.93 |
| KIAA1468 | 0.91 | 0.92 |
| MTPN | 0.90 | 0.91 |
| G3BP2 | 0.90 | 0.93 |
| BTRC | 0.90 | 0.91 |
| STAM | 0.90 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FXYD1 | -0.68 | -0.68 |
| HIGD1B | -0.66 | -0.67 |
| MT-CO2 | -0.65 | -0.67 |
| AF347015.21 | -0.64 | -0.66 |
| AL139819.3 | -0.64 | -0.67 |
| AP002478.3 | -0.64 | -0.68 |
| TLCD1 | -0.63 | -0.64 |
| AF347015.31 | -0.63 | -0.65 |
| AC021016.1 | -0.63 | -0.62 |
| CLDN10 | -0.62 | -0.63 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0019992 | diacylglycerol binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016188 | synaptic vesicle maturation | IEA | Synap (GO term level: 8) | - |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| GO:0006887 | exocytosis | IEA | - | |
| GO:0050435 | beta-amyloid metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
| RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-129-5p | 3967 | 3974 | 1A,m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-130/301 | 4641 | 4648 | 1A,m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
| hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
| hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
| hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
| miR-133 | 4188 | 4194 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-15/16/195/424/497 | 894 | 901 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-19 | 4640 | 4646 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-218 | 601 | 607 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-224 | 4577 | 4583 | m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| miR-450 | 3967 | 3973 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
| miR-503 | 895 | 901 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
| miR-9 | 4190 | 4196 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.