Gene Page: CAND2

Summary
GeneID  23066
Symbol  CAND2
Synonyms  KIAA0667|TIP120B|Tp120b
Description  cullin-associated and neddylation-dissociated 2 (putative)
See related  HGNC:30689|MIM:610403|Ensembl:ENSG00000144712|
Locus tag  -
Gene type  protein-coding
Map location  3p25.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.006 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0017025TATA-binding protein bindingIEA-
GO:0016563transcription activator activityISS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
GO:0006511ubiquitin-dependent protein catabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIDA12692129 
GO:0005634nucleusIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CNOT3KIAA0691 | LENG2 | NOT3 | NOT3HCCR4-NOT transcription complex, subunit 3Reconstituted Complex
Two-hybrid
BioGRID12207886 
UBE3CKIAA0010 | KIAA10ubiquitin protein ligase E3CBiochemical ActivityBioGRID12692129 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506145151m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.