Gene Page: ZNF423
Summary ?
| GeneID | 23090 |
| Symbol | ZNF423 |
| Synonyms | Ebfaz|JBTS19|NPHP14|OAZ|Roaz|ZFP423|Zfp104|hOAZ |
| Description | zinc finger protein 423 |
| Reference | MIM:604557|HGNC:HGNC:16762|Ensembl:ENSG00000102935|HPRD:05189|Vega:OTTHUMG00000173491 |
| Gene type | protein-coding |
| Map location | 16q12 |
| Pascal p-value | 0.026 |
| Fetal beta | 1.797 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg27360784 | 16 | 49525304 | ZNF423 | 5.786E-4 | 0.297 | 0.049 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| UBR3 | 0.95 | 0.96 |
| DMXL2 | 0.94 | 0.94 |
| TMEM30A | 0.94 | 0.94 |
| ATP6V1A | 0.93 | 0.94 |
| CLTC | 0.93 | 0.93 |
| PJA2 | 0.93 | 0.94 |
| DNAJC6 | 0.93 | 0.92 |
| BAG4 | 0.92 | 0.94 |
| COL4A3BP | 0.92 | 0.93 |
| AC010896.1 | 0.92 | 0.94 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RAB34 | -0.56 | -0.64 |
| C1orf61 | -0.55 | -0.72 |
| DBI | -0.53 | -0.62 |
| C1orf54 | -0.53 | -0.61 |
| HIGD1B | -0.52 | -0.56 |
| AP002478.3 | -0.52 | -0.59 |
| FXYD1 | -0.51 | -0.54 |
| EFEMP2 | -0.51 | -0.55 |
| SAT1 | -0.51 | -0.59 |
| PLA2G5 | -0.51 | -0.53 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0016564 | transcription repressor activity | IDA | 10660046 | |
| GO:0016563 | transcription activator activity | IDA | 10660046 | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0016481 | negative regulation of transcription | IDA | 10660046 | |
| GO:0030154 | cell differentiation | IEA | - | |
| GO:0045941 | positive regulation of transcription | IDA | 10660046 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | IDA | 10660046 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
| ASTON MAJOR DEPRESSIVE DISORDER UP | 49 | 36 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 1 DN | 163 | 115 | All SZGR 2.0 genes in this pathway |
| HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
| MCLACHLAN DENTAL CARIES DN | 245 | 144 | All SZGR 2.0 genes in this pathway |
| MOLENAAR TARGETS OF CCND1 AND CDK4 UP | 67 | 48 | All SZGR 2.0 genes in this pathway |
| BUCKANOVICH T LYMPHOCYTE HOMING ON TUMOR DN | 24 | 16 | All SZGR 2.0 genes in this pathway |
| BONCI TARGETS OF MIR15A AND MIR16 1 | 91 | 75 | All SZGR 2.0 genes in this pathway |
| CAIRO LIVER DEVELOPMENT UP | 166 | 105 | All SZGR 2.0 genes in this pathway |
| HOELZEL NF1 TARGETS DN | 115 | 73 | All SZGR 2.0 genes in this pathway |
| PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP | 134 | 85 | All SZGR 2.0 genes in this pathway |
| BILANGES SERUM SENSITIVE GENES | 90 | 54 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-145 | 588 | 594 | m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
| miR-15/16/195/424/497 | 135 | 141 | 1A | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-203.1 | 254 | 260 | m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
| miR-204/211 | 649 | 656 | 1A,m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
| hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
| miR-216 | 174 | 180 | 1A | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
| miR-224 | 611 | 618 | 1A,m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| miR-23 | 608 | 614 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| miR-323 | 608 | 614 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
| miR-328 | 56 | 62 | m8 | hsa-miR-328brain | CUGGCCCUCUCUGCCCUUCCGU |
| miR-330 | 516 | 523 | 1A,m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| miR-369-3p | 311 | 318 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU | ||||
| miR-374 | 140 | 147 | 1A,m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG | ||||
| miR-421 | 128 | 134 | m8 | hsa-miR-421 | GGCCUCAUUAAAUGUUUGUUG |
| miR-496 | 104 | 110 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-503 | 134 | 141 | 1A,m8 | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.