Gene Page: ARL6IP1

Summary
GeneID  23204
Symbol  ARL6IP1
Synonyms  AIP1|ARL6IP|ARMER|KIAA0069
Description  ADP-ribosylation factor-like 6 interacting protein 1
See related  HGNC:697|MIM:607669|Ensembl:ENSG00000170540|HPRD:09641|
Locus tag  -
Gene type  protein-coding
Map location  16p12-p11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006613cotranslational protein targeting to membraneIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0012505endomembrane systemIEA-
GO:0005829cytosolIEA-
GO:0005737cytoplasmIEA-
GO:0005784translocon complexIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARL4DARF4L | ARL6ADP-ribosylation factor-like 4D-HPRD10508919 
ARL6BBS3 | MGC32934ADP-ribosylation factor-like 6-HPRD,BioGRID10508919 
FBXW7AGO | CDC4 | DKFZp686F23254 | FBW6 | FBW7 | FBX30 | FBXO30 | FBXW6 | FLJ16457 | SEL-10 | SEL10F-box and WD repeat domain containing 7Two-hybridBioGRID16169070 
FDFT1DGPT | ERG9 | SQS | SSfarnesyl-diphosphate farnesyltransferase 1Two-hybridBioGRID16169070 
FXR2FMR1L2fragile X mental retardation, autosomal homolog 2Two-hybridBioGRID16189514 
INPP5KPPS | SKIPinositol polyphosphate-5-phosphatase KTwo-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-148/152128212891A,m8hsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-1505175231Ahsa-miR-150UCUCCCAACCCUUGUACCAGUG
miR-221/222137313791Ahsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-4863843901Ahsa-miR-486UCCUGUACUGAGCUGCCCCGAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.