Gene Page: FLT4

Summary
GeneID  2324
Symbol  FLT4
Synonyms  FLT41|LMPH1A|PCL|VEGFR3
Description  fms-related tyrosine kinase 4
See related  HGNC:3767|MIM:136352|Ensembl:ENSG00000037280|HPRD:00636|
Locus tag  -
Gene type  protein-coding
Map location  5q35.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.0276 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005021vascular endothelial growth factor receptor activityIDA9012504 
GO:0005021vascular endothelial growth factor receptor activityIEA-
GO:0004872receptor activityIEA-
GO:0005515protein bindingIEA-
GO:0005515protein bindingIPI16530705 
GO:0005524ATP bindingIEA-
GO:0004713protein tyrosine kinase activityIEA-
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007169transmembrane receptor protein tyrosine kinase signaling pathwayIEA-
GO:0006468protein amino acid phosphorylationIEA-
GO:0008284positive regulation of cell proliferationIEA-
GO:0008284positive regulation of cell proliferationIGI11574540 
GO:0048010vascular endothelial growth factor receptor signaling pathwayIDA9012504 
GO:0048010vascular endothelial growth factor receptor signaling pathwayIGI11574540 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0005887integral to plasma membraneTAS8386825 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
FIGFVEGF-D | VEGFDc-fos induced growth factor (vascular endothelial growth factor D)-HPRD9435229 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2-HPRD,BioGRID7675451 |7970715 
|8662748 |9927207 
ITGB1CD29 | FNRB | GPIIA | MDF2 | MSK12 | VLA-BETA | VLABintegrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)-HPRD,BioGRID11553610 
SHC1FLJ26504 | SHC | SHCASHC (Src homology 2 domain containing) transforming protein 1-HPRD7675451 |8662748 
|9927207 
Affinity Capture-Western
Reconstituted Complex
BioGRID7970715 |8662748 
|9927207 
VEGFCFlt4-L | VRPvascular endothelial growth factor CVEGF-C interacts with VEGFR-3. This interaction was modeled on a demonstrated interaction between human VEGF-C and VEGFR-3 from an unspecified species.BIND12810700 
-HPRD,BioGRID8700872 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-505656662m8hsa-miR-505GUCAACACUUGCUGGUUUCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.