Gene Page: SMG6
Summary ?
| GeneID | 23293 |
| Symbol | SMG6 |
| Synonyms | C17orf31|EST1A|SMG-6|hSMG5/7a |
| Description | SMG6 nonsense mediated mRNA decay factor |
| Reference | MIM:610963|HGNC:HGNC:17809|Ensembl:ENSG00000070366|HPRD:06502|Vega:OTTHUMG00000177578 |
| Gene type | protein-coding |
| Map location | 17p13.3 |
| Pascal p-value | 1.769E-8 |
| Sherlock p-value | 0.534 |
| Fetal beta | 0.452 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs8077351 | chr17 | 2545472 | SMG6 | 23293 | 0.09 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| NME3 | 0.75 | 0.74 |
| HDHD3 | 0.74 | 0.74 |
| GAMT | 0.72 | 0.75 |
| PSMG4 | 0.72 | 0.72 |
| BOLA1 | 0.71 | 0.70 |
| ILVBL | 0.71 | 0.73 |
| POMGNT1 | 0.70 | 0.68 |
| NTHL1 | 0.69 | 0.71 |
| C9orf142 | 0.69 | 0.67 |
| RANGRF | 0.69 | 0.61 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MT-ATP8 | -0.41 | -0.48 |
| AF347015.2 | -0.40 | -0.42 |
| AF347015.15 | -0.39 | -0.43 |
| AF347015.8 | -0.39 | -0.43 |
| AF347015.26 | -0.39 | -0.45 |
| AF347015.18 | -0.38 | -0.45 |
| COBLL1 | -0.38 | -0.37 |
| ABCG2 | -0.37 | -0.41 |
| MT-CYB | -0.36 | -0.42 |
| CALD1 | -0.36 | -0.39 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 12699629 | |
| GO:0004519 | endonuclease activity | IEA | - | |
| GO:0016787 | hydrolase activity | IEA | - | |
| GO:0042162 | telomeric DNA binding | IDA | 12699629 | |
| GO:0030145 | manganese ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000184 | nuclear-transcribed mRNA catabolic process, nonsense-mediated decay | TAS | 16488880 | |
| GO:0000723 | telomere maintenance | IMP | 12699629 | |
| GO:0006406 | mRNA export from nucleus | TAS | 16488880 | |
| GO:0035303 | regulation of dephosphorylation | TAS | 15721257 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000781 | chromosome, telomeric region | IEA | - | |
| GO:0005634 | nucleus | IDA | 14636577 | |
| GO:0005694 | chromosome | IEA | - | |
| GO:0005697 | telomerase holoenzyme complex | TAS | 12699629 | |
| GO:0005737 | cytoplasm | IDA | 14636577 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID TELOMERASE PATHWAY | 68 | 48 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF MRNA | 284 | 128 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF RNA | 330 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NONSENSE MEDIATED DECAY ENHANCED BY THE EXON JUNCTION COMPLEX | 176 | 57 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP | 211 | 136 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS G UP | 238 | 135 | All SZGR 2.0 genes in this pathway |
| OLSSON E2F3 TARGETS UP | 28 | 14 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
| BILANGES SERUM SENSITIVE VIA TSC2 | 39 | 25 | All SZGR 2.0 genes in this pathway |
| TERAO AOX4 TARGETS SKIN UP | 38 | 27 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-199 | 8 | 14 | m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
| miR-299-5p | 112 | 118 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-7 | 122 | 128 | 1A | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.