Gene Page: ITGB3BP

Summary
GeneID  23421
Symbol  ITGB3BP
Synonyms  CENP-R|CENPR|HSU37139|NRIF3|TAP20
Description  integrin beta 3 binding protein (beta3-endonexin)
See related  HGNC:6157|MIM:605494|Ensembl:ENSG00000142856|HPRD:09267|
Locus tag  -
Gene type  protein-coding
Map location  1p31.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.02692 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004871signal transducer activityTAS10490654 
GO:0008022protein C-terminus bindingTAS10490654 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007155cell adhesionTAS7593198 
GO:0006350transcriptionIEA-
GO:0007165signal transductionTAS7593198 |10490654 
GO:0006915apoptosisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000775chromosome, centromeric regionIEA-
GO:0005624membrane fractionTAS7593198 
GO:0005634nucleusTAS10490654 
GO:0005694chromosomeIEA-
GO:0005737cytoplasmTAS7593198 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARFIP2POR1ADP-ribosylation factor interacting protein 2Two-hybridBioGRID16189514 
CCNA2CCN1 | CCNAcyclin A2-HPRD,BioGRID10673397 
COL4A3BPCERT | CERTL | FLJ20597 | GPBP | STARD11collagen, type IV, alpha 3 (Goodpasture antigen) binding proteinTwo-hybridBioGRID16189514 
DDX24-DEAD (Asp-Glu-Ala-Asp) box polypeptide 24Two-hybridBioGRID16169070 
ITGB3CD61 | GP3A | GPIIIaintegrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)-HPRD,BioGRID7593198 |11864709 
ITGB3BPCENP-R | CENPR | HSU37139 | NRIF3 | TAP20integrin beta 3 binding protein (beta3-endonexin)-HPRD,BioGRID11713274 
ITGB5FLJ26658integrin, beta 5in vivoBioGRID10579726 
MTA1-metastasis associated 1MTA1 interacts with NRIF3.BIND15254226 
NFKB1DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105nuclear factor of kappa light polypeptide gene enhancer in B-cells 1-HPRD,BioGRID12244126 
RECQL5FLJ90603 | RECQ5RecQ protein-like 5Two-hybridBioGRID16169070 
RELAMGC131774 | NFKB3 | p65v-rel reticuloendotheliosis viral oncogene homolog A (avian)-HPRD,BioGRID12244126 
RXRAFLJ00280 | FLJ00318 | FLJ16020 | FLJ16733 | MGC102720 | NR2B1retinoid X receptor, alpha-HPRD,BioGRID10490654 
RXRGNR2B3 | RXRCretinoid X receptor, gammaTwo-hybridBioGRID11713274 
THRAAR7 | EAR7 | ERB-T-1 | ERBA | ERBA1 | MGC000261 | MGC43240 | NR1A1 | THRA1 | THRA2 | c-ERBA-1thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)Reconstituted Complex
Two-hybrid
BioGRID10490654 |11713274 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1511321381Ahsa-miR-151brainACUAGACUGAAGCUCCUUGAGG
miR-203.1204210m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-221501561Ahsa-miR-22brainAAGCUGCCAGUUGAAGAACUGU
miR-4961931991Ahsa-miR-496AUUACAUGGCCAAUCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.