Gene Page: PSD4

Summary
GeneID  23550
Symbol  PSD4
Synonyms  EFA6B|FLJ36237|FLJ37279|TIC
Description  pleckstrin and Sec7 domain containing 4
See related  HGNC:19096|Ensembl:ENSG00000125637|HPRD:15191|
Locus tag  -
Gene type  protein-coding
Map location  2q13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0004 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00755 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005086ARF guanyl-nucleotide exchange factor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0032012regulation of ARF protein signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005886plasma membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-2051201261Ahsa-miR-205UCCUUCAUUCCACCGGAGUCUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.