Gene Page: ARFIP2

Summary
GeneID  23647
Symbol  ARFIP2
Synonyms  POR1
Description  ADP-ribosylation factor interacting protein 2
See related  HGNC:17160|MIM:601638|Ensembl:ENSG00000132254|HPRD:07209|
Locus tag  -
Gene type  protein-coding
Map location  11p15
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.2235 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005525GTP bindingTAS8670882 
GO:0030742GTP-dependent protein bindingIPI9312003 
GO:0030742GTP-dependent protein bindingTAS9312003 
GO:0048365Rac GTPase bindingTAS9312003 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006928cell motionTAS8670882 
GO:0007264small GTPase mediated signal transductionTAS8670882 
GO:0030036actin cytoskeleton organizationIMP9312003 
GO:0031529ruffle organizationTAS9312003 
GO:0030032lamellipodium biogenesisTAS9312003 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0001726ruffleIMP8670882 
GO:0005737cytoplasmTAS9312003 
GO:0005938cell cortexIDA9312003 
GO:0005886plasma membraneTAS9312003 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AKT1AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHAv-akt murine thymoma viral oncogene homolog 1Two-hybridBioGRID9312003 
ARF1-ADP-ribosylation factor 1-HPRD,BioGRID9038142 
ARF3-ADP-ribosylation factor 3-HPRD,BioGRID9038142 
ARF5-ADP-ribosylation factor 5-HPRD,BioGRID9038142 
ARF6DKFZp564M0264ADP-ribosylation factor 6-HPRD,BioGRID9312003 
ARFIP2POR1ADP-ribosylation factor interacting protein 2-HPRD,BioGRID11346801 
ARL1ARFL1ADP-ribosylation factor-like 1Two-hybridBioGRID12972563 
DTNBP1DBND | DKFZp564K192 | FLJ30031 | HPS7 | MGC20210 | My031 | SDYdystrobrevin binding protein 1Two-hybridBioGRID16189514 
ITGB3BPCENP-R | CENPR | HSU37139 | NRIF3 | TAP20integrin beta 3 binding protein (beta3-endonexin)Two-hybridBioGRID16189514 
RAC1MGC111543 | MIG5 | TC-25 | p21-Rac1ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)Co-crystal Structure
Reconstituted Complex
Two-hybrid		BioGRID8670882 |11346801 
|11478794 
-HPRD8670882 |11478794 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1334484551A,m8hsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-192/2156046101Ahsa-miR-192CUGACCUAUGAAUUGACAGCC
hsa-miR-215AUGACCUAUGAAUUGACAGAC
miR-22356362m8hsa-miR-22brainAAGCUGCCAGUUGAAGAACUGU
miR-3283793851Ahsa-miR-328brainCUGGCCCUCUCUGCCCUUCCGU
miR-384569575m8hsa-miR-384AUUCCUAGAAAUUGUUCAUA
miR-409-5p9929981Ahsa-miR-409-5pAGGUUACCCGAGCAACUUUGCA
miR-9451457m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.