Gene Page: TRIM29

Summary
GeneID  23650
Symbol  TRIM29
Synonyms  ATDC|FLJ36085
Description  tripartite motif-containing 29
See related  HGNC:17274|MIM:610658|Ensembl:ENSG00000137699|HPRD:10280|
Locus tag  -
Gene type  protein-coding
Map location  11q22-q23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.006 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityTAS8188213 
GO:0005515protein bindingIPI16189514 
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006366transcription from RNA polymerase II promoterTAS8188213 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CEP70BITE | FLJ13036centrosomal protein 70kDaTwo-hybridBioGRID16189514 
EFCAB4BFLJ33805 | MGC4266EF-hand calcium binding domain 4BTwo-hybridBioGRID16189514 
FBF1Alb | FBF-1 | FLJ00103Fas (TNFRSF6) binding factor 1Two-hybridBioGRID16189514 
FXR2FMR1L2fragile X mental retardation, autosomal homolog 2Two-hybridBioGRID16189514 
GCC1FLJ22035 | GCC1P | GCC88 | MGC20706GRIP and coiled-coil domain containing 1Affinity Capture-Western
Two-hybrid		BioGRID16189514 
GOLGA2GM130 | MGC20672golgi autoantigen, golgin subfamily a, 2Two-hybridBioGRID16189514 
JAKMIP2JAMIP2 | KIAA0555 | NECC1janus kinase and microtubule interacting protein 2Two-hybridBioGRID16189514 
LZTS2KIAA1813 | LAPSER1leucine zipper, putative tumor suppressor 2Two-hybridBioGRID16189514 
MAD1L1HsMAD1 | MAD1 | PIG9 | TP53I9 | TXBP181MAD1 mitotic arrest deficient-like 1 (yeast)Two-hybridBioGRID16189514 
MID2FXY2 | MID1 | RNF60 | TRIM1midline 2-HPRD,BioGRID11331580 
MLH1COCA2 | FCC2 | HNPCC | HNPCC2 | MGC5172 | hMLH1mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)Two-hybridBioGRID16189514 
MYO15BFLJ21606 | FLJ22686 | FLJ40577 | FLJ44494 | MYO15BPmyosin XVB pseudogeneTwo-hybridBioGRID16189514 
PRKCAAAG6 | MGC129900 | MGC129901 | PKC-alpha | PKCA | PRKACAprotein kinase C, alpha-HPRD7644499 
TRIM11BIA1 | RNF92tripartite motif-containing 11-HPRD,BioGRID11331580 
TRIM23ARD1 | ARFD1 | RNF46tripartite motif-containing 23-HPRD,BioGRID11331580 
TRIM27RFP | RNF76tripartite motif-containing 27-HPRD,BioGRID11331580 
TRIM29ATDC | FLJ36085tripartite motif-containing 29Two-hybridBioGRID11331580 |16189514 
TSGA10CEP4Ltestis specific, 10Two-hybridBioGRID16189514 
UBE2IC358B7.1 | P18 | UBC9ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)Two-hybridBioGRID16189514 
VIMFLJ36605vimentin-HPRD7644499 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-299-5p111111171Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.