Gene Page: KIF4A

Summary
GeneID  24137
Symbol  KIF4A
Synonyms  FLJ12530|FLJ12655|FLJ14204|FLJ20631|HSA271784|KIF4|KIF4-G1
Description  kinesin family member 4A
See related  HGNC:13339|MIM:300521|Ensembl:ENSG00000090889|HPRD:06606|
Locus tag  -
Gene type  protein-coding
Map location  Xq13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003777microtubule motor activityTAS7929562 
GO:0003677DNA bindingIEA-
GO:0005515protein bindingIPI17353931 
GO:0005524ATP bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008089anterograde axon cargo transportTASaxon (GO term level: 9)7929562 
GO:0007018microtubule-based movementIEA-
GO:0006996organelle organizationTAS7929562 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005875microtubule associated complexIEA-
GO:0005876spindle microtubuleTAS7929562 
GO:0005634nucleusIEA-
GO:0005737cytoplasmTAS7929562 
GO:0016363nuclear matrixIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DNMT3BICF | M.HsaIIIBDNA (cytosine-5-)-methyltransferase 3 betaCo-purification
Reconstituted Complex
BioGRID15148359 
DNPEPASPEP | DAPaspartyl aminopeptidaseAffinity Capture-MSBioGRID17353931 
HMG20BBRAF25 | BRAF35 | FLJ26127 | HMGX2 | PP7706 | SMARCE1r | SOXL | pp8857high-mobility group 20B-HPRD,BioGRID12809554 
TTF2HuF2transcription termination factor, RNA polymerase II-HPRD12927788 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-223236242m8hsa-miR-223UGUCAGUUUGUCAAAUACCCC
miR-5435275331Ahsa-miR-543AAACAUUCGCGGUGCACUUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.