Gene Page: EML2

Summary
GeneID  24139
Symbol  EML2
Synonyms  ELP70|EMAP-2|EMAP2
Description  echinoderm microtubule associated protein like 2
See related  HGNC:18035|Ensembl:ENSG00000125746|HPRD:16860|
Locus tag  -
Gene type  protein-coding
Map location  19q13.32
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004252serine-type endopeptidase activityIEAglutamate (GO term level: 7)-
GO:0005509calcium ion bindingIEA-
GO:0005515protein bindingIPI17353931 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006508proteolysisIEA-
GO:0007605sensory perception of soundTAS10521658 
GO:0007601visual perceptionTAS10521658 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005874microtubuleIEA-
GO:0005875microtubule associated complexTAS10521658 
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NEK6SID6-1512NIMA (never in mitosis gene a)-related kinase 6Affinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3268086m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.