Gene Page: C6orf167

Summary
GeneID  253714
Symbol  C6orf167
Synonyms  DKFZp686C20164|DKFZp781C2113|FLJ46180|KIAA1900|dJ39B17.2
Description  chromosome 6 open reading frame 167
See related  HGNC:21475|Ensembl:ENSG00000146263|HPRD:12865|
Locus tag  -
Gene type  protein-coding
Map location  6q16.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI17353931 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ASF1BCIA-II | FLJ10604ASF1 anti-silencing function 1 homolog B (S. cerevisiae)Affinity Capture-MSBioGRID17353931 
FBXW7AGO | CDC4 | DKFZp686F23254 | FBW6 | FBW7 | FBX30 | FBXO30 | FBXW6 | FLJ16457 | SEL-10 | SEL10F-box and WD repeat domain containing 7Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-186439844051A,m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-200bc/42937843790m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.