Gene Page: KCTD13
Summary ?
| GeneID | 253980 |
| Symbol | KCTD13 |
| Synonyms | BACURD1|FKSG86|PDIP1|POLDIP1|hBACURD1 |
| Description | potassium channel tetramerization domain containing 13 |
| Reference | MIM:608947|HGNC:HGNC:22234|Ensembl:ENSG00000174943|HPRD:12339|Vega:OTTHUMG00000132120 |
| Gene type | protein-coding |
| Map location | 16p11.2 |
| Pascal p-value | 1.261E-9 |
| Sherlock p-value | 0.277 |
| Fetal beta | 0.219 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
CV:PGC128
| SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
|---|---|---|---|---|---|---|---|
| rs12691307 | chr16 | 29939877 | AG | 1.298E-10 | intergenic | KCTD13,TMEM219 | dist=2324;dist=33474 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs9968605 | chr5 | 124299675 | KCTD13 | 253980 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005249 | voltage-gated potassium channel activity | IEA | - | |
| GO:0042802 | identical protein binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006260 | DNA replication | ISS | 15726626 | |
| GO:0006813 | potassium ion transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0008076 | voltage-gated potassium channel complex | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 UP | 140 | 94 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 187 | 193 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.