Gene Page: ZDHHC23

Summary
GeneID  254887
Symbol  ZDHHC23
Synonyms  MGC42530|NIDD
Description  zinc finger, DHHC-type containing 23
See related  HGNC:28654|Ensembl:ENSG00000184307|HPRD:15717|
Locus tag  -
Gene type  protein-coding
Map location  3q13.31
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04359 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.04047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NOS1IHPS1 | NOS | nNOSnitric oxide synthase 1 (neuronal)Affinity Capture-Western
Reconstituted Complex
BioGRID15105416 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.18208261Ahsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-21811941200m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-34/449105710641A,m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.