Gene Page: TCERG1L
Summary ?
| GeneID | 256536 |
| Symbol | TCERG1L |
| Synonyms | - |
| Description | transcription elongation regulator 1 like |
| Reference | HGNC:HGNC:23533|Ensembl:ENSG00000176769|HPRD:18170|Vega:OTTHUMG00000019276 |
| Gene type | protein-coding |
| Map location | 10q26.3 |
| Pascal p-value | 0.469 |
| Sherlock p-value | 0.035 |
| eGene | Cerebellum Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03487 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs16827037 | chr3 | 117203284 | TCERG1L | 256536 | 0.03 | trans | ||
| rs614566 | chr3 | 182847389 | TCERG1L | 256536 | 0.2 | trans | ||
| rs16891454 | chr8 | 42485539 | TCERG1L | 256536 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-153 | 243 | 249 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-216 | 701 | 707 | m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
| miR-299-5p | 764 | 770 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-381 | 722 | 728 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-448 | 243 | 249 | 1A | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| miR-493-5p | 643 | 649 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-494 | 154 | 160 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
| miR-539 | 709 | 715 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.