Gene Page: ATXN10

Summary
GeneID  25814
Symbol  ATXN10
Synonyms  E46L|FLJ37990|SCA10
Description  ataxin 10
See related  HGNC:10549|MIM:611150|Ensembl:ENSG00000130638|HPRD:04624|
Locus tag  RP1-37M3.7
Gene type  protein-coding
Map location  22q13.31
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 3 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
GO:0005515protein bindingIPI17353931 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentIMPneurite (GO term level: 5)16385455 
GO:0008219cell deathIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0043025cell somaIDAaxon, dendrite (GO term level: 4)15201271 
GO:0030425dendriteIDAneuron, axon, dendrite (GO term level: 6)15201271 
GO:0005737cytoplasmIDA15201271 
GO:0048471perinuclear region of cytoplasmIDA15201271 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BSG5F7 | CD147 | EMMPRIN | M6 | OK | TCSFbasigin (Ok blood group)Affinity Capture-MSBioGRID17353931 
GSTK1GST13glutathione S-transferase kappa 1Affinity Capture-MSBioGRID17353931 
MAGED1DLXIN-1 | NRAGEmelanoma antigen family D, 1Affinity Capture-MSBioGRID17353931 
STYXL1DUSP24 | MK-STYXserine/threonine/tyrosine interacting-like 1Affinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1284344411A,m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-27435441m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-5394294351Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.