Gene Page: FBXL2
Summary ?
| GeneID | 25827 |
| Symbol | FBXL2 |
| Synonyms | FBL2|FBL3 |
| Description | F-box and leucine-rich repeat protein 2 |
| Reference | MIM:605652|HGNC:HGNC:13598|Ensembl:ENSG00000153558|HPRD:05736| |
| Gene type | protein-coding |
| Map location | 3p22.3 |
| Pascal p-value | 0.002 |
| Sherlock p-value | 0.214 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | TAS | 10508920 | |
| GO:0004842 | ubiquitin-protein ligase activity | TAS | 10531037 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006464 | protein modification process | TAS | 10531035 | |
| GO:0006508 | proteolysis | TAS | 10531035 | |
| GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | TAS | 10508920 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN | 162 | 102 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR DN | 86 | 62 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 10HR DN | 56 | 37 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR DN | 101 | 70 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 6HR DN | 160 | 101 | All SZGR 2.0 genes in this pathway |
| YOKOE CANCER TESTIS ANTIGENS | 38 | 22 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
| NIELSEN MALIGNAT FIBROUS HISTIOCYTOMA DN | 18 | 11 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-133 | 652 | 659 | 1A,m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-141/200a | 341 | 348 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-218 | 348 | 354 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-9 | 571 | 578 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.