Gene Page: UNC50

Summary
GeneID  25972
Symbol  UNC50
Synonyms  DKFZp564G0222|GMH1|HSD23|UNCL|URP
Description  unc-50 homolog (C. elegans)
See related  HGNC:16046|Ensembl:ENSG00000115446|HPRD:18259|
Locus tag  -
Gene type  protein-coding
Map location  2q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0004 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003723RNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0015031protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneIEA-
GO:0005794Golgi apparatusIEA-
GO:0005634nucleusIEA-
GO:0005637nuclear inner membraneIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-203.1180186m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-493-5p176182m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.