Gene Page: LRRTM2
Summary ?
| GeneID | 26045 |
| Symbol | LRRTM2 |
| Synonyms | - |
| Description | leucine rich repeat transmembrane neuronal 2 |
| Reference | MIM:610868|HGNC:HGNC:19409|Ensembl:ENSG00000146006|HPRD:17454|Vega:OTTHUMG00000163535 |
| Gene type | protein-coding |
| Map location | 5q31.2 |
| Pascal p-value | 0.723 |
| Sherlock p-value | 0.836 |
| Fetal beta | 0.866 |
| eGene | Meta |
| Support | G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TPI1 | 0.80 | 0.84 |
| FDX1L | 0.80 | 0.83 |
| NQO2 | 0.80 | 0.80 |
| STUB1 | 0.79 | 0.77 |
| ST6GALNAC6 | 0.78 | 0.80 |
| MDH1 | 0.78 | 0.79 |
| RUNDC3A | 0.78 | 0.80 |
| COX5B | 0.78 | 0.83 |
| CAMK1 | 0.78 | 0.79 |
| COX17 | 0.78 | 0.76 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AC005035.1 | -0.59 | -0.61 |
| THOC2 | -0.59 | -0.61 |
| MAP4K4 | -0.58 | -0.60 |
| KIAA1949 | -0.54 | -0.46 |
| FNBP1L | -0.54 | -0.43 |
| SBF2 | -0.54 | -0.46 |
| ZCCHC11 | -0.54 | -0.46 |
| ZNF551 | -0.54 | -0.42 |
| AC004017.1 | -0.54 | -0.43 |
| EPB41 | -0.54 | -0.48 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
| MOLENAAR TARGETS OF CCND1 AND CDK4 UP | 67 | 48 | All SZGR 2.0 genes in this pathway |
| YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-141/200a | 177 | 183 | 1A | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-224 | 743 | 749 | 1A | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| miR-30-3p | 320 | 327 | 1A,m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
| hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
| miR-410 | 263 | 269 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-496 | 3182 | 3188 | m8 | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.