Gene Page: SENP6

Summary
GeneID  26054
Symbol  SENP6
Synonyms  FLJ11355|FLJ11887|KIAA0389|KIAA0797|SSP1|SUSP1
Description  SUMO1/sentrin specific peptidase 6
See related  HGNC:20944|MIM:605003|Ensembl:ENSG00000112701|HPRD:05417|
Locus tag  RP1-134M13.1
Gene type  protein-coding
Map location  6q13-q14.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008234cysteine-type peptidase activityIEA-
GO:0008233peptidase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006508proteolysisIEA-
GO:0006511ubiquitin-dependent protein catabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
SUMO1DAP-1 | GMP1 | OFC10 | PIC1 | SENP2 | SMT3 | SMT3C | SMT3H3 | SUMO-1 | UBL1SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)-HPRD10799485 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1863293361A,m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-421181187m8hsa-miR-421GGCCUCAUUAAAUGUUUGUUG
miR-4952352411Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.