Gene Page: ABCA12

Summary
GeneID  26154
Symbol  ABCA12
Synonyms  DKFZp434G232|FLJ41584|ICR2B|LI2
Description  ATP-binding cassette, sub-family A (ABC1), member 12
See related  HGNC:14637|MIM:607800|Ensembl:ENSG00000144452|HPRD:07416|
Locus tag  -
Gene type  protein-coding
Map location  2q34
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00916 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01016 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005524ATP bindingNAS12697999 
GO:0016887ATPase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006869lipid transportNAS12915478 
GO:0019725cellular homeostasisNAS12697999 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneNAS12697999 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-32010341040m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-338243249m8hsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.