Gene Page: GFRA3
Summary ?
| GeneID | 2676 |
| Symbol | GFRA3 |
| Synonyms | GDNFR3 |
| Description | GDNF family receptor alpha 3 |
| Reference | MIM:605710|HGNC:HGNC:4245|Ensembl:ENSG00000146013|HPRD:10420|Vega:OTTHUMG00000129200 |
| Gene type | protein-coding |
| Map location | 5q31.1-q31.3 |
| Pascal p-value | 0.044 |
| Fetal beta | 0.413 |
| DMG | 1 (# studies) |
| eGene | Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 6 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg21225170 | 5 | 137610391 | GFRA3 | 9.31E-8 | -0.022 | 2.11E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MYO18B | 0.34 | 0.18 |
| CHRNA6 | 0.33 | 0.11 |
| CHRNA3 | 0.30 | 0.24 |
| GRID2IP | 0.30 | 0.24 |
| COX6A2 | 0.29 | 0.21 |
| NPL | 0.29 | 0.16 |
| ABCA13 | 0.29 | 0.19 |
| MYO3B | 0.29 | 0.18 |
| RGS16 | 0.28 | 0.12 |
| PARVG | 0.28 | 0.14 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TRPV6 | -0.16 | -0.19 |
| PNLDC1 | -0.16 | -0.17 |
| KCNS1 | -0.13 | -0.07 |
| AC016705.1 | -0.13 | -0.11 |
| AC011472.2 | -0.13 | -0.08 |
| RBP7 | -0.13 | -0.17 |
| CPS1 | -0.13 | -0.15 |
| KIAA0748 | -0.13 | -0.20 |
| AC083862.2 | -0.12 | -0.12 |
| C13orf16 | -0.12 | -0.17 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008046 | axon guidance receptor activity | IEA | axon (GO term level: 6) | - |
| GO:0005102 | receptor binding | TAS | Neurotransmitter (GO term level: 4) | 9407096 |
| GO:0004872 | receptor activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007411 | axon guidance | IEA | axon (GO term level: 13) | - |
| GO:0001764 | neuron migration | IEA | neuron (GO term level: 8) | - |
| GO:0048666 | neuron development | IEA | neuron (GO term level: 9) | - |
| GO:0048485 | sympathetic nervous system development | IEA | neuron, Neurotransmitter (GO term level: 7) | - |
| GO:0007165 | signal transduction | TAS | 9490034 |9576965 | |
| GO:0007422 | peripheral nervous system development | TAS | 9576965 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0009897 | external side of plasma membrane | IEA | - | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0031225 | anchored to membrane | IEA | - | |
| GO:0019898 | extrinsic to membrane | TAS | 9490034 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
| KANG IMMORTALIZED BY TERT DN | 102 | 67 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| ASGHARZADEH NEUROBLASTOMA POOR SURVIVAL DN | 46 | 30 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-224 | 581 | 587 | 1A | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.