|
|
| GeneID |
27013
|
| Symbol |
C2orf24
|
| Synonyms |
CGI-57
|
| Description |
chromosome 2 open reading frame 24 |
| See related |
HGNC:25220|Ensembl:ENSG00000115649|HPRD:10780| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
2q35 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_IIA | genome scan meta-analysis (All samples) | Psr: 0.00916 | | | GSMA_IIE | genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0016020 | membrane | IEA | | - |
| GO:0016021 | integral to membrane | IEA | | - |
| |
|
|
| miR-330 | 625 | 631 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA | | miR-7 | 533 | 540 | 1A,m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|