Gene Page: GJB1

Summary
GeneID  2705
Symbol  GJB1
Synonyms  CMTX|CMTX1|CX32
Description  gap junction protein, beta 1, 32kDa
See related  HGNC:4283|MIM:304040|Ensembl:ENSG00000169562|HPRD:02367|
Locus tag  -
Gene type  protein-coding
Map location  Xq13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0109 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005243gap junction channel activityEXP9184217 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentTASneurite (GO term level: 5)8266101 
GO:0007267cell-cell signalingTAS8266101 
GO:0006810transportTAS2875078 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005789endoplasmic reticulum membraneEXP9184217 
GO:0016021integral to membraneIEA-
GO:0005922connexon complexTAS2875078 
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
GJB2CX26 | DFNA3 | DFNB1 | HID | KID | NSRD1 | PPKgap junction protein, beta 2, 26kDa-HPRD9592087 
JUPARVD12 | CTNNG | DP3 | DPIII | PDGB | PKGBjunction plakoglobinAffinity Capture-WesternBioGRID7971964 
OCLN-occludin-HPRD,BioGRID10581193 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)GJB1 (connexin32) interacts with and prevents the activation of Src.BIND15782139 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1946096151Ahsa-miR-194UGUAACAGCAACUCCAUGUGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.