Gene Page: STK36

Summary
GeneID  27148
Symbol  STK36
Synonyms  DKFZp434N0223|FU|KIAA1278
Description  serine/threonine kinase 36, fused homolog (Drosophila)
See related  HGNC:17209|MIM:607652|Ensembl:ENSG00000163482|HPRD:09631|
Locus tag  -
Gene type  protein-coding
Map location  2q35
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01016 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00916 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0000287magnesium ion bindingIC10806483 
GO:0005524ATP bindingNAS-
GO:0005524ATP bindingTAS10806483 
GO:0004674protein serine/threonine kinase activityNAS-
GO:0004674protein serine/threonine kinase activityTAS10806483 
GO:0016740transferase activityIEA-
GO:0008134transcription factor bindingIDA10806483 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationNAS-
GO:0006468protein amino acid phosphorylationTAS10806483 
GO:0009791post-embryonic developmentISS-
GO:0051090regulation of transcription factor activityIDA10806483 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA10806483 
GO:0005737cytoplasmIDA10806483 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARMC6MGC19595 | R30923_1armadillo repeat containing 6Affinity Capture-MSBioGRID17353931 
CDK9C-2k | CDC2L4 | CTK1 | PITALRE | TAKcyclin-dependent kinase 9-HPRD9557739 
GLI1GLIglioma-associated oncogene homolog 1 (zinc finger protein)-HPRD,BioGRID10806483 
GLI2HPE9 | THP1 | THP2GLI-Kruppel family member GLI2-HPRD,BioGRID10806483 
GLI3ACLS | GCPS | PAP-A | PAPA | PAPA1 | PAPB | PHS | PPDIVGLI-Kruppel family member GLI3-HPRD,BioGRID10806483 
MAST2FLJ39200 | KIAA0807 | MAST205 | MTSSK | RP4-533D7.1microtubule associated serine/threonine kinase 2-HPRD12421765 
SUFUPRO1280 | SUFUH | SUFUXLsuppressor of fused homolog (Drosophila)-HPRD10806483 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3262182241Ahsa-miR-326CCUCUGGGCCCUUCCUCCAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.