Gene Page: PRELID1

Summary
GeneID  27166
Symbol  PRELID1
Synonyms  CGI-106|MGC87972|PRELI|PX19
Description  PRELI domain containing 1
See related  HGNC:30255|MIM:605733|Ensembl:ENSG00000169230|HPRD:16149|
Locus tag  -
Gene type  protein-coding
Map location  5q35.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.0276 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006955immune responseTAS10784606 
GO:0007275multicellular organismal developmentTAS10784606 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005739mitochondrionISS-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-4553423481Ahsa-miR-455UAUGUGCCUUUGGACUACAUCG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.