Gene Page: RPS6KA6

Summary
GeneID  27330
Symbol  RPS6KA6
Synonyms  RSK4
Description  ribosomal protein S6 kinase, 90kDa, polypeptide 6
See related  HGNC:10435|MIM:300303|Ensembl:ENSG00000072133|HPRD:02250|
Locus tag  -
Gene type  protein-coding
Map location  Xq21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0000287magnesium ion bindingIEA-
GO:0004867serine-type endopeptidase inhibitor activityIEA-
GO:0005524ATP bindingIEA-
GO:0004674protein serine/threonine kinase activityIEA-
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007417central nervous system developmentTASBrain (GO term level: 6)10644430 
GO:0006468protein amino acid phosphorylationIEA-
GO:0007243protein kinase cascadeIEA-
GO:0007165signal transductionTAS10644430 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA18029348 
GO:0005730nucleolusIDA18029348 
GO:0005730nucleolusIDA18029348 
GO:0005737cytoplasmIDA18029348 
GO:0005739mitochondrionIDA18029348 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NR4A1GFRP1 | HMR | MGC9485 | N10 | NAK-1 | NGFIB | NP10 | NUR77 | TR3nuclear receptor subfamily 4, group A, member 1Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-26951021A,m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.