Gene Page: GOLGA2

Summary
GeneID  2801
Symbol  GOLGA2
Synonyms  GM130|MGC20672
Description  golgi autoantigen, golgin subfamily a, 2
See related  HGNC:4425|MIM:602580|Ensembl:ENSG00000167110|HPRD:03989|
Locus tag  -
Gene type  protein-coding
Map location  9q34.11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI15194699 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusIDA15229288 
GO:0016020membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ABLIM1ABLIM | DKFZp781D0148 | FLJ14564 | KIAA0059 | LIMAB1 | LIMATIN | MGC1224actin binding LIM protein 1Two-hybridBioGRID16189514 
DISC1C1orf136 | FLJ13381 | FLJ21640 | FLJ25311 | FLJ41105 | KIAA0457 | SCZD9disrupted in schizophrenia 1An unspecified isoform of DISC1 interacts with GM130.BIND14623284 
GORASP1FLJ23443 | GOLPH5 | GRASP65 | MGC118894 | MGC118897 | P65golgi reassembly stacking protein 1, 65kDaAffinity Capture-Western
Co-localization
in vitro
in vivo
Reconstituted Complex		BioGRID9628863 |11739401 
|11739402 |11781572 
-HPRD9628863 |11739402 
|11781572 
GORASP2DKFZp434D156 | FLJ13139 | GOLPH6 | GRASP55 | GRS2 | p59golgi reassembly stacking protein 2, 55kDa-HPRD,BioGRID10487747 
GPS2AMF-1 | MGC104294 | MGC119287 | MGC119288 | MGC119289G protein pathway suppressor 2Two-hybridBioGRID16169070 
POM121DKFZp586G1822 | DKFZp586P2220 | FLJ41820 | KIAA0618 | MGC3792 | POM121APOM121 membrane glycoprotein (rat)Two-hybridBioGRID16189514 
RAB1ADKFZp564B163 | RAB1 | YPT1RAB1A, member RAS oncogene family-HPRD,BioGRID11739401 
RAB1B-RAB1B, member RAS oncogene family-HPRD,BioGRID11306556 
RAB2ARAB2RAB2A, member RAS oncogene family-HPRD,BioGRID11739401 
RAB33BDKFZp434G099 | MGC138182RAB33B, member RAS oncogene family-HPRD,BioGRID11718716 
RAB6ARAB6 | RAB6A' | RAB6BRAB6A, member RAS oncogene familyReconstituted ComplexBioGRID11718716 
RUSC2Iporin | KIAA0375RUN and SH3 domain containing 2RUSC2 (Iporin) interacts with GOLGA2 (GM130).BIND15796781 
TMED2FLJ21323 | P24A | RNP24transmembrane emp24 domain trafficking protein 2-HPRD11703931 
Affinity Capture-WesternBioGRID11739402 
TRIM29ATDC | FLJ36085tripartite motif-containing 29Two-hybridBioGRID16189514 
TUBGCP476P | FLJ14797 | GCP4tubulin, gamma complex associated protein 4Two-hybridBioGRID16189514 
USO1P115 | TAP | VDPUSO1 homolog, vesicle docking protein (yeast)Reconstituted ComplexBioGRID10931861 
-HPRD9478999 
ZNF250FLJ57354 | MGC111123 | MGC9718 | ZFP647 | ZNF647zinc finger protein 250Two-hybridBioGRID16189514 
ZNF594DKFZp667J055zinc finger protein 594Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-381102210281Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.