|
|
| GeneID |
2805
|
| Symbol |
GOT1
|
| Synonyms |
GIG18
|
| Description |
glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) |
| See related |
HGNC:4432|MIM:138180|Ensembl:ENSG00000120053|HPRD:00687| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
10q24.1-q25.1 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
| ENTPD4 | 0.82 | 0.88 | | |
| ARHGEF11 | 0.82 | 0.86 | | |
| EIF4G3 | 0.81 | 0.87 | | |
| USP31 | 0.80 | 0.86 | | |
| SENP5 | 0.79 | 0.85 | | |
| ARHGEF7 | 0.78 | 0.87 | | |
| ADAT1 | 0.78 | 0.85 | | |
| UBE4A | 0.78 | 0.85 | | |
| MAP3K13 | 0.78 | 0.86 | | |
| VPS53 | 0.78 | 0.85 | | |
Top 10 negatively co-expressed genes | | AF347015.31 | -0.62 | -0.70 | | |
| AF347015.21 | -0.62 | -0.72 | | |
| MT-CO2 | -0.59 | -0.68 | | |
| AF347015.8 | -0.59 | -0.67 | | |
| FXYD1 | -0.59 | -0.65 | | |
| CST3 | -0.58 | -0.67 | | |
| HIGD1B | -0.58 | -0.69 | | |
| APOE | -0.58 | -0.67 | | |
| S100A16 | -0.58 | -0.65 | | |
| METRN | -0.57 | -0.67 | | |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0004069 | aspartate transaminase activity | EXP | glutamate (GO term level: 6) | 2241899 |
| GO:0004069 | aspartate transaminase activity | IDA | glutamate (GO term level: 6) | 2182221 |2241899 |2731362
|6391741 |
| GO:0030170 | pyridoxal phosphate binding | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0006520 | amino acid metabolic process | IEA | | - |
| GO:0006533 | aspartate catabolic process | IDA | | 2241899 |
| GO:0009058 | biosynthetic process | IEA | | - |
| GO:0032869 | cellular response to insulin stimulus | IEP | | 8396422 |
| GO:0051384 | response to glucocorticoid stimulus | IEP | | 8396422 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005829 | cytosol | EXP | | 2241899 |
| GO:0005737 | cytoplasm | IDA | | 7060339 |
| |
|
| miR-9 | 24 | 30 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
