Gene Page: C1orf104

Summary
GeneID  284618
Symbol  C1orf104
Synonyms  FLJ35976|RP11-21N7.3
Description  chromosome 1 open reading frame 104
See related  HGNC:26680|HPRD:08767|
Locus tag  -
Gene type  protein-coding
Map location  1q22
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-7271277m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.