Gene Page: NKIRAS1

Summary
GeneID  28512
Symbol  NKIRAS1
Synonyms  KBRAS1|kappaB-Ras1
Description  NFKB inhibitor interacting Ras-like 1
See related  HGNC:17899|MIM:604496|Ensembl:ENSG00000197885|HPRD:06841|
Locus tag  -
Gene type  protein-coding
Map location  3p24.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.006 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003924GTPase activityNAS10657303 
GO:0005525GTP bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007264small GTPase mediated signal transductionIEA-
GO:0007249I-kappaB kinase/NF-kappaB cascadeNAS10657303 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NFKBIBIKBB | TRIP9nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, betaAffinity Capture-WesternBioGRID12672800 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-17-5p/20/93.mr/106/519.d1411481A,m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.