Gene Page: SH3PXD2B

Summary
GeneID  285590
Symbol  SH3PXD2B
Synonyms  FAD49|FLJ20831|HOFI|KIAA1295
Description  SH3 and PX domains 2B
See related  HGNC:29242|Ensembl:ENSG00000174705|HPRD:18591|
Locus tag  -
Gene type  protein-coding
Map location  5q35.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.0276 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0035091phosphoinositide bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007154cell communicationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-137439844041Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-182178017861Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-96177917861A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.