Gene Page: TBK1

Summary
GeneID  29110
Symbol  TBK1
Synonyms  FLJ11330|NAK|T2K
Description  TANK-binding kinase 1
See related  HGNC:11584|MIM:604834|Ensembl:ENSG00000183735|HPRD:05322|
Locus tag  -
Gene type  protein-coding
Map location  12q14.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0045 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005515protein bindingIPI16887178 
GO:0005524ATP bindingIEA-
GO:0004674protein serine/threonine kinase activityIEA-
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationIEA-
GO:0009615response to virusIEA-
GO:0043123positive regulation of I-kappaB kinase/NF-kappaB cascadeIEP12761501 
GO:0045087innate immune responseIEA-
GO:0044419interspecies interaction between organismsIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005829cytosolEXP12692549 
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ANKRD28KIAA0379 | PITKankyrin repeat domain 28Affinity Capture-MSBioGRID14743216 
ATP5A1ATP5A | ATP5AL2 | ATPM | MOM2 | OMR | ORM | hATP1ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle-HPRD14743216 
AZI2AZ2 | NAP1 | TILP5-azacytidine induced 2-HPRD14743216 
BTRCBETA-TRCP | FBW1A | FBXW1 | FBXW1A | FWD1 | MGC4643 | bTrCP | bTrCP1 | betaTrCPbeta-transducin repeat containingAffinity Capture-MSBioGRID14743216 
CCT6ACCT-zeta | CCT-zeta-1 | CCT6 | Cctz | HTR3 | MGC126214 | MGC126215 | MoDP-2 | TCP-1-zeta | TCP20 | TCPZ | TTCP20chaperonin containing TCP1, subunit 6A (zeta 1)-HPRD14743216 
CCT8C21orf112 | Cctq | D21S246 | KIAA0002 | PRED71chaperonin containing TCP1, subunit 8 (theta)-HPRD14743216 
CDC37P50CDC37cell division cycle 37 homolog (S. cerevisiae)Affinity Capture-MSBioGRID14743216 
CUL1MGC149834 | MGC149835cullin 1Affinity Capture-MSBioGRID14743216 
HNRNPMDKFZp547H118 | HNRNPM4 | HNRPM | HNRPM4 | HTGR1 | NAGR1heterogeneous nuclear ribonucleoprotein M-HPRD14743216 
HSP90AA2HSP90ALPHA | HSPCA | HSPCAL3heat shock protein 90kDa alpha (cytosolic), class A member 2Affinity Capture-MSBioGRID14743216 
HSPA8HSC54 | HSC70 | HSC71 | HSP71 | HSP73 | HSPA10 | LAP1 | MGC131511 | MGC29929 | NIP71heat shock 70kDa protein 8-HPRD14743216 
IKBKGAMCBX1 | FIP-3 | FIP3 | Fip3p | IKK-gamma | IP | IP1 | IP2 | IPD2 | NEMOinhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gammaAffinity Capture-MSBioGRID14743216 
NCK1MGC12668 | NCK | NCKalphaNCK adaptor protein 1-HPRD,BioGRID7706279 
NFKB1DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105nuclear factor of kappa light polypeptide gene enhancer in B-cells 1Affinity Capture-MSBioGRID14743216 
NFKB2LYT-10 | LYT10nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)Affinity Capture-MSBioGRID14743216 
PPP6CFLJ92648 | MGC12249protein phosphatase 6, catalytic subunitAffinity Capture-MSBioGRID14743216 
RELC-Relv-rel reticuloendotheliosis viral oncogene homolog (avian)Affinity Capture-MSBioGRID14743216 
RELAMGC131774 | NFKB3 | p65v-rel reticuloendotheliosis viral oncogene homolog A (avian)Affinity Capture-MSBioGRID14743216 
RUVBL2CGI-46 | ECP51 | INO80J | REPTIN | RVB2 | TIH2 | TIP48 | TIP49BRuvB-like 2 (E. coli)-HPRD14743216 
SAPS1KIAA1115 | MGC138185 | MGC142003 | PP6R1 | SAP190SAPS domain family, member 1Affinity Capture-MSBioGRID14743216 
SAPS2KIAA0685 | PP6R2 | SAP190 | dJ579N16.1SAPS domain family, member 2Affinity Capture-MSBioGRID14743216 
SKP1EMC19 | MGC34403 | OCP-II | OCP2 | SKP1A | TCEB1L | p19AS-phase kinase-associated protein 1Affinity Capture-MSBioGRID14743216 
TANKI-TRAF | TRAF2TRAF family member-associated NFKB activator-HPRD,BioGRID10581243 
TBKBP1KIAA0775 | ProSAPiP2TBK1 binding protein 1-HPRD,BioGRID14743216 
TICAM1MGC35334 | PRVTIRB | TICAM-1 | TRIFtoll-like receptor adaptor molecule 1TRIF interacts with TBK1.BIND14530355 
TRAF2MGC:45012 | TRAP | TRAP3TNF receptor-associated factor 2-HPRD,BioGRID10990461 
TUBA3CTUBA2 | bA408E5.3tubulin, alpha 3c-HPRD14743216 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-135246252m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-1932391A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-200bc/429101107m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-493-5p1261331A,m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-5397137201A,m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.