Gene Page: BRD7

Summary
GeneID  29117
Symbol  BRD7
Synonyms  BP75|CELTIX1|NAG4
Description  bromodomain containing 7
See related  HGNC:14310|Ensembl:ENSG00000166164|
Locus tag  -
Gene type  protein-coding
Map location  16q12
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008134transcription factor bindingIDA11025449 
GO:0042393histone bindingIDA12489984 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006357regulation of transcription from RNA polymerase II promoterIDA12489984 
GO:0016055Wnt receptor signaling pathwayIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA11025449 |12489984 
GO:0005737cytoplasmTAS10526152 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AGR2AG2 | GOB-4 | HAG-2 | XAG-2anterior gradient homolog 2 (Xenopus laevis)Two-hybridBioGRID16169070 
BHLHB2DEC1 | SHARP-2 | STRA13 | Stra14 | bHLHe40basic helix-loop-helix domain containing, class B, 2Two-hybridBioGRID16169070 
BRD3FLJ23227 | FLJ41328 | KIAA0043 | ORFX | RING3Lbromodomain containing 3-HPRD12600283 
BTBD2-BTB (POZ) domain containing 2Two-hybridBioGRID16169070 
DVL1DVL | MGC54245dishevelled, dsh homolog 1 (Drosophila)-HPRD12941796 
FTH1FHC | FTH | FTHL6 | MGC104426 | PIG15 | PLIFferritin, heavy polypeptide 1Two-hybridBioGRID16169070 
HAP1HAP2 | HIP5 | HLP | hHLP1huntingtin-associated protein 1-HPRD15383276 
HIST1H2ALH2A.i | H2A/i | H2AFI | HIST1H2AM | dJ193B12.9histone cluster 1, H2al-HPRD12489984 
HIST2H2BEGL105 | H2B | H2B.1 | H2B/q | H2BFQ | MGC119802 | MGC119804 | MGC129733 | MGC129734histone cluster 2, H2be-HPRD12489984 
HIST2H3AH3/n | H3/ohistone cluster 2, H3a-HPRD12489984 
HIST3H3H3.4 | H3/g | H3FT | H3t | MGC126886 | MGC126888histone cluster 3, H3-HPRD12489984 
HIST4H4H4/p | MGC24116histone cluster 4, H4-HPRD12489984 
HNRNPUL1E1B-AP5 | E1BAP5 | FLJ12944 | HNRPUL1heterogeneous nuclear ribonucleoprotein U-like 1-HPRD,BioGRID12489984 
IRF2DKFZp686F0244 | IRF-2interferon regulatory factor 2Reconstituted Complex
Two-hybrid		BioGRID11025449 
LAMA4DKFZp686D23145 | LAMA3 | LAMA4*-1laminin, alpha 4Two-hybridBioGRID16169070 
NEFLCMT1F | CMT2E | FLJ53642 | NF-L | NF68 | NFLneurofilament, light polypeptide-HPRD15383276 
PAFAH1B3-platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDaTwo-hybridBioGRID16169070 
PSMD11MGC3844 | Rpn6 | S9 | p44.5proteasome (prosome, macropain) 26S subunit, non-ATPase, 11Two-hybridBioGRID16169070 
PTPN13DKFZp686J1497 | FAP-1 | PNP1 | PTP-BAS | PTP-BL | PTP1E | PTPL1 | PTPLEprotein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)-HPRD10526152 
RPLP1FLJ27448 | MGC5215 | P1 | RPP1ribosomal protein, large, P1Two-hybridBioGRID16169070 
SERPINB9CAP-3 | CAP3 | PI9serpin peptidase inhibitor, clade B (ovalbumin), member 9Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-381144150m8hsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-493-5p2733m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.