Gene Page: SLC25A5

Summary
GeneID  292
Symbol  SLC25A5
Synonyms  2F1|AAC2|ANT2|T2|T3
Description  solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
See related  HGNC:10991|MIM:300150|Ensembl:ENSG00000005022|HPRD:02147|
Locus tag  -
Gene type  protein-coding
Map location  Xq24-q26
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0139 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
GO:0005215transporter activityIEA-
GO:0015207adenine transmembrane transporter activityTAS2168878 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006810transportTAS2168878 
GO:0044419interspecies interaction between organismsIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005739mitochondrionIEA-
GO:0005743mitochondrial inner membraneEXP10620603 
GO:0005743mitochondrial inner membraneIEA-
GO:0016020membraneIEA-
GO:0005887integral to plasma membraneTAS2168878 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CKMT1BCKMT | CKMT1 | UMTCKcreatine kinase, mitochondrial 1B-HPRD11602586 
TRADDHs.89862 | MGC11078TNFRSF1A-associated via death domain-HPRD14743216 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-134209215m8hsa-miR-134brainUGUGACUGGUUGACCAGAGGG
miR-135160166m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-1371261331A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-3612182241Ahsa-miR-361brainUUAUCAGAAUCUCCAGGGGUAC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.