|
|
| GeneID |
2979
|
| Symbol |
GUCA1B
|
| Synonyms |
DKFZp686E1183|GCAP2|GUCA2
|
| Description |
guanylate cyclase activator 1B (retina) |
| See related |
HGNC:4679|MIM:602275|Ensembl:ENSG00000112599|HPRD:03783| |
| Locus tag |
RP1-139D8.1 |
| Gene type |
protein-coding |
| Map location |
6p21.1 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_I | genome scan meta-analysis | Psr: 0.033 | | | GSMA_IIE | genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | | | Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia] | Click to show detail |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
| ABCC12 | 0.61 | 0.54 | | |
| EPHX4 | 0.56 | 0.49 | | |
| PIGP | 0.55 | 0.40 | | |
| STEAP1 | 0.55 | 0.44 | | |
| SMYD2 | 0.54 | 0.58 | | |
| TNFSF13B | 0.53 | 0.40 | | |
| MPL | 0.53 | 0.42 | | |
| SH3GLB2 | 0.53 | 0.49 | | |
| CCK | 0.53 | 0.48 | | |
| ATG7 | 0.53 | 0.52 | | |
Top 10 negatively co-expressed genes | | SMTN | -0.28 | -0.27 | | |
| GPR125 | -0.28 | -0.24 | | |
| SH3BP2 | -0.28 | -0.32 | | |
| GLIS2 | -0.27 | -0.26 | | |
| PDE9A | -0.27 | -0.32 | | |
| SEMA3F | -0.26 | -0.30 | | |
| SH2D2A | -0.26 | -0.29 | | |
| PKN1 | -0.26 | -0.26 | | |
| FAM59B | -0.26 | -0.24 | | |
| C16orf88 | -0.26 | -0.17 | | |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005509 | calcium ion binding | IEA | | - |
| GO:0008048 | calcium sensitive guanylate cyclase activator activity | TAS | | 1409606 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0007267 | cell-cell signaling | TAS | | 1409606 |
| GO:0007168 | receptor guanylyl cyclase signaling pathway | TAS | | 1327879 |
| GO:0007601 | visual perception | IEA | | - |
| GO:0007589 | body fluid secretion | TAS | | 1327879 |
| GO:0050896 | response to stimulus | IEA | | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005886 | plasma membrane | IEA | | - |
| |
|
|
| |
|
| miR-494 | 930 | 936 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
